01 Basic Quality Report

Cookbook 01: Basic Quality Report #

Use Case #

You have FastQ files from a sequencing run and want to generate comprehensive quality reports to assess:

  • Read quality scores
  • Base composition
  • Read length distribution
  • Duplicate read counts

This is typically the first step in any sequencing data analysis to understand data quality before downstream processing.

What This Pipeline Does #

  1. Reads input FastQ file(s)
  2. Generates a comprehensive quality report including:
    • Base quality statistics
    • Base distribution across positions
    • Read length distribution
    • Duplicate read counting
  3. Outputs reports in both HTML (human-readable) and JSON (machine-readable) formats
  4. Passes through all reads unchanged (no filtering)

Input Files #

  • input/sample_R1.fq - Forward reads (Read 1) from paired-end sequencing

Output Files #

  • output_R1.fq - Passed-through reads (identical to input)
  • output.report_initial.html - HTML quality report
  • output.report_initial.json - JSON quality report with detailed statistics

When to Use This #

  • First analysis of new sequencing data
  • Quality control before committing to expensive downstream analysis
  • Comparing data quality across different sequencing runs
  • Identifying potential issues (adapter contamination, quality drop-off, etc.)

Download #

Download 01-basic-quality-report.tar.gz for a complete, runnable example including expected output files.

Configuration File #

[input]
    # Single-end reads for this example
    # For paired-end data, you would also include: read2 = 'input/sample_R2.fq'
    read1 = 'input/sample_R1.fq'

[[step]]
  action = "CalcGCContent"
  out_label = "gc_content"

[[step]]
    # Generate a comprehensive quality report
    action = 'Report'
    name = 'initial'

    # Count total number of reads
    count = true

    # Analyze base quality scores and GC content
    base_statistics = true
    # Analyze the distribution of read lengths

    length_distribution = true

    # Count duplicate reads (identical sequences)
    duplicate_count_per_read = true

    # Count duplicate reads (identical sequences)
    duplicate_count_per_fragment = true

    # count how often these oligos occur.
    # no mismatches, no IUPAC
	count_oligos = [
		'AAAAAA',
		'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC',
		'ATCTCGTATGCCGTCTTCTGCTTG',
		'GGGGGGGGGGG',
	]

    # Histogram of gc content (rounded to nearest integer)
  # optional
    tag_histograms = ["gc_content"]


[output]
    # Output prefix for all files
    prefix = 'reference_output/output'

    # Generate both HTML and JSON reports
    report_html = true
    report_json = true

    # Output format (FASTQ = uncompressed FASTQ format)
    format = "FASTQ"